Nouveaux prix de services à la baisse en vigueur le 1er septembre 2017. Contactez-nous à infoservices@genomequebec.com pour plus de détails.

Foire aux questions

Mode d'affichage

Questions générales

Les questions fréquemment posées pour cette section ainsi que leur réponses ne sont présentement pas disponibles. Vous pouvez cependant adresser vos questions directement au Bureau de gestion clients

Nanuq
  1. Je n'ai plus mon mot de passe ou mon nom d'usager Nanuq. Que faire ?
  2. Quand j'essaie d'accéder à Nanuq, j'ai un message avertissant que la connexion que je tente d'établir pose un problème de sécurité. Pourquoi, et que faire ?
  3. Nanuq ne répond pas. Que faire ?
  4. J'aimerais avoir accès à Nanuq. à qui dois-je m'adresser ?
  5. Qu'est-ce que Nanuq?
  6. J'ai demandé des données à Nanuq et je n'ai jamais reçu le courriel m'avisant que les données étaient disponibles pour téléchargement. Quel est le problème ?
  7. Nanuq ne fonctionne pas correctement. Que faire ?
  8. Je n'arrive pas soumettre le Formulaire de demande de séquençage. Comment puis-je vous le faire parvenir ?
  9. Je n'arrive pas à télécharger mon rapport de génotype en suivant le lien reçu par courriel. Que se passe-t-il ?
  10. J'ai fait une demande de résultats d'hybridation, pour laquelle j'ai reçu un courriel m'avisant que les données sont disponibles sur Nanuq. Or, je ne les vois pas. Que se passe-t-il ?
  11. Suite à une demande d'accès à Nanuq, j'ai reçu un courriel avec mon nom d'usager et mon mot de passe. Mais je n'arrive pas à me connecter car Nanuq ne me reconnaît pas. Que se passe-t-il ?
  12. Je n'arrive pas à soumettre le formulaire Excel pour mes échantillons de séquençage. Quel est le problème ?
  13. J'ai envoyé une requête à Nanuq, et je suis toujours sans nouvelle. Que se passe-t-il ?
Réponses - Questions relatives à Nanuq
Nanuq
  1. Je n'ai plus mon mot de passe ou mon nom d'usager Nanuq. Que faire ?

    Sur la page d'accueil de Nanuq, cliquer sur le lien "Mot de passe perdu", puis saisir l'adresse courriel associée à votre compte

  2. Quand j'essaie d'accéder à Nanuq, j'ai un message avertissant que la connexion que je tente d'établir pose un problème de sécurité. Pourquoi, et que faire ?

    Ce message est "normal". En effet, bien que Nanuq utilise une connexion sécurisée (https et non http), nous n'avons pas de certificat émanant d'une autorité reconnue (ex. VeriSign), d'où l'avertissement. Il suffit d'accepter la connexion et, éventuellement, d'ajouter le site de Nanuq à la liste des sites autorisés dans son fureteur favoris

  3. Nanuq ne répond pas. Que faire ?

    Vérifier d'abord que votre accès Internet fonctionne bien. Si oui, contactez le soutien technique par courriel ou au 514-398-3311 #00173. Donnez le maximum d'information possible (ex. les symptômes : page blanche, message d'erreur, aucune réponse; le message d'erreur s'il y en a un, quel fureteur vous utilisez, etc.).

  4. J'aimerais avoir accès à Nanuq. à qui dois-je m'adresser ?

    Vous devez vous adresser directement au service avec lequel vous avez des projets. Les coordonnées de ces services sont disponibles sur la page de contact.

  5. Qu'est-ce que Nanuq?

    Nanuq est le portail web par lequel vous accédez aux données de vos projets au Centre d'innovation Génome Québec et Université McGill. Voici une description plus détaillée de Nanuq.

  6. J'ai demandé des données à Nanuq et je n'ai jamais reçu le courriel m'avisant que les données étaient disponibles pour téléchargement. Quel est le problème ?

    Il y a plus d'une cause possible.

    1. Le courriel sera envoyé à l'adresse associée au compte Nanuq utilisé pour la requête. Assurez-vous de consulter cette adresse courriel. Pour connaître cette adresse, consultez le lien "Mon profil" sur la page d'accueil de Nanuq.
    2. Le courriel a bel et bien été envoyé, mais a été intercepté par votre serveur de courriel. Regardez dans les courriels indésirables, la poubelle ou ailleurs. Si vous le repérez, ajoutez l'expéditeur de ce courriel à la liste des expéditeurs approuvés afin que cela ne se reproduise plus.
    3. Il y a eu un problème du côté de Nanuq. Contactez le soutien technique de Nanuq.
  7. Nanuq ne fonctionne pas correctement. Que faire ?

    Contactez le soutien technique par courriel ou au 514-398-3311 #00173. Donnez le maximum d'information possible (ex. les symptômes : page blanche, message d'erreur, aucune réponse; le message d'erreur s'il y en a un, quel fureteur vous utilisez, etc.).

  8. Je n'arrive pas soumettre le Formulaire de demande de séquençage. Comment puis-je vous le faire parvenir ?

    Envoyez-le par courriel directement au Bureau de gestion des clients.

  9. Je n'arrive pas à télécharger mon rapport de génotype en suivant le lien reçu par courriel. Que se passe-t-il ?

    Il y a plus d'une cause possible, mais de loin la plus probable est la suivante. Le rapport a déjà été téléchargé une première fois. Dans ce cas, il n'est malheureusement plus disponible et doit être redemandé. Si ce n'est pas le cas, contactez le soutien technique par courriel ou au 514-398-3311 #00173. Donnez le maximum d'information possible (ex. les symptômes : page blanche, message d'erreur, aucune réponse; le message d'erreur s'il y en a un, quel fureteur vous utilisez, etc.).

  10. J'ai fait une demande de résultats d'hybridation, pour laquelle j'ai reçu un courriel m'avisant que les données sont disponibles sur Nanuq. Or, je ne les vois pas. Que se passe-t-il ?

    Il y a plus d'une cause possible, mais de loin la plus probable est la suivante. Les données sont conservées et rendues disponibles 7 jours. Après ce délai, elles ne sont malheureusement plus disponibles et doivent être redemandées. Si ce n'est pas le cas, contactez le soutien technique par courriel ou au 514-398-3311 #00173. Donnez le maximum d'information possible (ex. les symptômes : page blanche, message d'erreur, aucune réponse; le message d'erreur s'il y en a un, quel fureteur vous utilisez, etc.).

  11. Suite à une demande d'accès à Nanuq, j'ai reçu un courriel avec mon nom d'usager et mon mot de passe. Mais je n'arrive pas à me connecter car Nanuq ne me reconnaît pas. Que se passe-t-il ?

    Il y a plus d'une cause possible, mais de loin la plus probable est la suivante. Une faute de frappe est commise lors de la saisie du nom d'usager et/ou du mot de passe. Par exemple, il y a confusion entre les caractères I (lettre I majuscule), l (lettre L minuscule) et 1 (chiffre 1). Si vous avez procédé par copier-coller, assurez-vous de ne pas avoir inclus d'espace en début ou en fin de saisie. Si le problème persiste, cliquez sur le lien "mot de passe perdu" afin de demander un nouveau mot de passe. Si le problème persiste toujours, contactez le soutien technique par courriel ou au 514-398-3311 #00173. Donnez le maximum d'information possible (ex. les symptômes : page blanche, message d'erreur, aucune réponse; le message d'erreur s'il y en a un, quel fureteur vous utilisez, etc.).

  12. Je n'arrive pas à soumettre le formulaire Excel pour mes échantillons de séquençage. Quel est le problème ?

    Il y a plus d'une cause possible.

    1. Assurez-vous d'avoir la bonne version du formulaire. Pour en être certain, téléchargez-le à partir de Nanuq plutôt que de réutiliser une copie précédente.
    2. Attention aux fautes de frappe, surtout lorsque vous procédez par copier-coller-modifier.

    Si le problème persiste toujours, contactez le soutien technique par courriel ou au 514-398-3311 #00173. Donnez le maximum d'information possible (ex. les symptômes : page blanche, message d'erreur, aucune réponse; le message d'erreur s'il y en a un, quel fureteur vous utilisez, etc.).

  13. J'ai envoyé une requête à Nanuq, et je suis toujours sans nouvelle. Que se passe-t-il ?

    Normalement, vous devriez avoir reçu un accusé de réception dans les minutes ou les heures suivant votre demande. Si ce n'est pas le cas, soumettez votre requête à nouveau. Vous pouvez également nous téléphoner au 514-398-3311 #00173.

    Si vous avez reçu un accusé de réception, mais que votre requête demeure toujours sans réponse, vous pouvez faire un suivi en répondant ("Reply") à l'accusé de réception précédemment reçu. Vous pouvez également nous téléphoner au 514-398-3311 #00173.

Les questions fréquemment posées pour cette section ainsi que leur réponses ne sont présentement pas disponibles. Vous pouvez cependant adresser vos questions directement au Bureau de gestion clients

  1. Quel type d'échantillons puis-je soumettre?
  2. Comment dois-je isoler mes ARNs?
  3. Quelle est la procédure lorsque la quantité ou la qualité des ARNc générés est insuffisante?
  4. Quelle quantité d'ARN est nécessaire pour un projet?
  5. Combien d'échantillons puis-je soumettre?
  6. Qu'est-ce que le RIN?
  7. Comment interpréter le profile de Bioanalyseur?
  8. Quels sont les délais?
  9. Comment vais-je accéder à mes données?
  10. Qui aura accès à mes données?
  11. Gardez-vous toutes les données?
  12. Que devrais-je faire une fois mes données téléchargées?
  13. Dans le cas d'une publication, devrais-je mentionner le Centre d'innovation?
  14. Quelle sont les différences entre les trois technologies employées?
  15. Est-il recommandé de comparer les données obtenues à des moments différents?
  16. Est-il recommandé de comparer les données obtenues par des technologies différentes?
  17. Le Centre d'innovation offre-t-il un service d'analyse de données?
  18. Est-il nécessaire d'avoir des réplicas d'échantillons dans un projet?
  19. Est-il nécessaire d'envoyer des échantillons d'ARN sur glace sèche?
  20. Est-il possible de récupérer le reste de mes échantillons?
  21. Pourquoi le nom de nos échantillons dans Nanuq est-il différent du nom que nous avons soumis?
  22. Quelles mesures sont incluses dans les tests de CQ?
Réponses
  1. Quel type d'échantillons puis-je soumettre?
  2. Seuls les ARNs totaux sont acceptés

  3. Comment dois-je isoler mes ARNs?
  4. Le Centre d'innovation recommande l'utilisation de trousses commerciales telles que Qiagen. Si votre méthode d'extraction utilise du Trizol, une purification sur colonne Qiagen est recommandée. Si cette purification ne peut être faite par le client, l'équipe du service d'expression du Centre peut la faire.

  5. Quelle est la procédure lorsque la quantité ou la qualité des ARNc générés est insuffisante?
  6. Un échantillon contrôle est toujours ajouté aux échantillons des clients. Si ce contrôle présente le même problème que vos échantillons, le protocole sera refait à nos frais. Par contre, si l'échantillon contrôle ne présente aucun problème, le client devra décider si :

    • Il veut continuer avec l'échantillon tel quel en sachant que ses données finales pourraient être de moindre qualité. S'il s'agit d'une quantité insuffisante d'ARNc, il est possible de normaliser tous les autres ARNc pour hybrider la même quantité sur les biopuces. Par contre, il nous sera impossible de garantir les résultats.
    • Il veut que le Centre d'innovation reprenne la préparation de l'ARNc pour cet échantillon. Si l'ARNc généré par la reprise est bon, nous allons assumer les coûts de la reprise. Or, si le problème persiste, l'utilisateur devra en assumer les coûts.
    • Il veut nous envoyer un échantillon de remplacement.
    • Il veut laisser tomber cet échantillon.
  7. Quelle quantité d'ARN est nécessaire pour un projet?
  8. La quantité d'ARN total de départ nécessaire varie pour chaque technologie:

    Agilent Affymetrix Illumina
    Quantité minimale Biopuces de 8 places: 25ng
    Biopuces de 4 places: 50ng
    Biopuces 3': 250ng
    Biopuces ST: 100ng
    250ng
    Volume minimum 1.5 µl 3 µl 11 µl

    Les tests de contrôle de la qualité nécessitent 3 µl d'ARN total qui ne sont pas inclus dans les volumes indiqués ci-haut. De plus, il est préférable de nous fournir assez de matériel pour effectuer le protocole deux fois en cas de problème technique.

  9. Combien d'échantillons puis-je soumettre?
  10. Le nombre d'échantillons soumis doit respecter le nombre de places sur les biopuces. Par exemple, seulement les multiples de 12 sont acceptés pour les biopuces Human HT-12 d'Illumina. Le nombre minimum d'échantillons accepté varie selon la technologie choisie:

    Agilent Affymetrix Illumina
    Nombre minimum d'échantillons 8 6 Human HT12 et Mouse WG-6 : 12
    Mouse Ref-8: 8
  11. Qu'est-ce que le RIN?
  12. RIN est l'abréviation de RNA Integrity Number. Le RIN est calculé par le logiciel du Bioanalyseur afin de déterminer l'intégrité des ARN et ADN. La valeur du RIN varie entre 1 et 10; un RIN de 10 étant le meilleur RIN possible. Nous ne recommandons pas d'utiliser des ARNs avec un RIN inférieur à 7.

  13. Comment interpréter le profile de Bioanalyseur?
  14. Le profile du Bioanalyseur présente les pics d'ARN ribosomaux de 18S et 28S. Le pic de 28S devrait être plus haut que le pic de 18S et l'aspect de la ligne de base est aussi important. La ligne de base devrait être le plus lisse possible et tout près de 0. Voici des exemples d'ARNs totaux de différentes qualités :

  15. Quels sont les délais?
  16. Les délais varient selon l'achalandage de la plateforme. À partir du moment où le Centre d'innovation a reçu tous les documents requis ainsi que les échantillons, les contrôles de qualité sont effectués dans les 5 jours ouvrables. Si tout se déroule bien, les résultats finaux sont accessibles au plus tard 10 jours ouvrables après la réception des biopuces.

  17. Comment vais-je accéder à mes données?
  18. Dans la majorité des cas, les résultats finaux sont accessibles via l'application Nanuq. Il faudra aller sur la page de votre projet et cliquer via "Requête de données expérimentales". Un courriel automatique vous sera envoyé lorsqu'il sera possible de consulter vos données. Il faudra alors cliquer sur "Collecte de données expérimentales", sélectionner les données désirées et les télécharger.

    Dans le cas où il ne serait pas possible de téléverser vos données dans Nanuq, vos résultats vous seront livrés par le biais d'un site ftp sécurisé.

  19. Qui aura accès à mes données?
  20. Seules les personnes dont les noms figurent sur le formulaire initial de demande de service ont accès aux données du projet dans l'application Nanuq.

  21. Gardez-vous toutes les données?
  22. Dans Nanuq, une fois la requête des données expérimentales faite, les résultats seront accessibles pendant 15 jours. Une fois cette période écoulée, il suffit de refaire une requête.

    Les résultats transmis par un site ftp sécurisé resteront accessibles pour 10 jours seulement.

  23. Que devrais-je faire une fois mes données téléchargées?
  24. Le Centre d'innovation vous propose certains logiciels d'analyse pour vos données d'expression.

    - MeV (Clustering, analyse différentielle une fois normalisé, etc.)
    - Bioconductor (Plus avancé)
    - Array Analysis
    - Microarray
    - GenomeStudio et le module "Gene Expression" (non gratuit)
    - GeneSpring (non gratuit)

  25. Dans le cas d'une publication, devrais-je mentionner le Centre d'innovation?
  26. Oui. Tout projet de recherche collaboratif ou service effectué au Centre d'innovation Génome Québec et Université McGill doit en mentionner la contribution et en aviser le Centre d'innovation. La contribution du personnel des plateformes peut être soulignée comme co-auteur sur les articles, leur affiliation devra alors être clairement identifiée. Dans d'autres cas, la contribution du personnel des plateformes et du Centre d'innovation peut simplement être mentionnée dans la section des remerciements des publications. Dans le cas de communications orales (ex. PowerPoint), l'utilisation du nom de Génome Québec et/ou d'un logo est suffisante. Un tiré à part de chaque publication devrait être acheminé au Centre d'innovation par la suite.

  27. Quelle sont les différences entre les trois technologies employées?
  28. Agilent Affymetrix Illumina
    Espèces Plusieurs organismes
    Puces sur mesure
    Biopuces 3': plusieurs espèces
    Biopuces ST: humain, souris, rat et CHO
    Souris et humain
    Nombre d'échantillons Multiples de 4 ou de 8, dépendamment de la biopuce Minimum de 6 échantillons, aucune autre restriction Multiples de 6, 8 ou 12, dépendamment de la biopuce
    Quantité de matériel de départ Biopuces de 8 places: 25ng
    Biopuces de 4 places: 50ng
    Biopuces 3': 250ng
    Biopuces ST: 100ng
    250ng
    Longueur de sondes 60nt 25nt 50nt
    Nombre de copies de chaque sonde 1 sonde par gène Biopuces 3':
      - 11 copies
    BiopuceExon:
      - 4 copies par exon
      - 40par gène
    Biopuces Gene ST:
      - 26 copies
    Biopuces de 6 et 8 places:
      - 30 copies
    Biopuces de 12 places:
      - 15 copies
    Isomères ciblés Non Biopuces 3': Non
    Biopuces ST: Oui
    Oui
    Site de liaison 3' Biopuces 3': 3'
    Biopuces ST: différentes sites sur toute la longueur du gène
    3'
  29. Est-il recommandé de comparer les données obtenues à des moments différents?
  30. Il est relativement simple de comparer les données obtenues par la même technologie à des moments différents avec les logiciels d'analyse de données accessibles. Par contre, traiter des échantillons hybridés à des moments différents introduit des effets de lot qui diminuent la sensibilité et la précision de l'analyse, car le nombre de faux-négatifs augmente. En revanche, le nombre de faux-positifs diminue, ce qui augmente la spécificité de l'analyse.

  31. Est-il recommandé de comparer les données obtenues par des technologies différentes?
  32. Bien qu'il soit possible de le faire, ce n'est pas recommandé. Une telle comparaison nécessiterait l'établissement de correspondances entre les sondes utilisées par chacune des technologies. La longueur, la spécificité et la cartographie génétique des sondes varient considérablement d'une technologie à l'autre, ce qui réduirait la pertinence de l'analyse.

  33. Le Centre d'innovation offre-t-il un service d'analyse de données?
  34. Oui, le Centre d'innovation offre des services de bio-informatique qui sont en mesure de prendre en charge le traitement de vos données ou tout simplement de vous diriger vers un outil d'analyse approprié.

  35. Est-il nécessaire d'avoir des réplicas d'échantillons dans un projet?
  36. Dans un projet d'expression génique, on cherche à déterminer l'impact de différentes conditions sur l'expression de gènes. Ainsi, nous suggérons d'avoir au moins trois réplicas. Plus le nombre de réplicas est grand, plus l'analyse bio-informatique est représentative.

    Il existe deux types de réplicas d'échantillons : réplicas techniques et réplicas biologiques. Nous recommandons de soumettre des réplicas biologiques plutôt que techniques.

  37. Est-il nécessaire d'envoyer des échantillons d'ARN sur glace sèche?
  38. Oui. Si des échantillons d'ARN arrivent dégelés, il est fort probable qu'ils soient dégradés puisque l'ARN se dégrade facilement. Lorsque nous recevons des échantillons sans glace sèche, nous en informons les usagers. Il est alors préférable de nous envoyer des échantillons de remplacement. Une bioanalyse des échantillons reçus dégelés ne sera pas effectuée à moins que l'usager en fasse la demande.

  39. Est-il possible de récupérer le reste de mes échantillons?
  40. Non, nous ne renvoyons pas les restants d'échantillons. C'est pourquoi nous recommandons de faire des aliquots avant de nous faire parvenir vos échantillons. Dans le cas où un usager tient à récupérer ses échantillons, une entente entre le chercheur principal et le gestionnaire de la plateforme doit être conclue et des frais seront encourus.

  41. Pourquoi le nom de nos échantillons dans Nanuq est-il différent du nom que nous avons soumis?
  42. Le Centre d'innovation change le nom des échantillons pour s'assurer que chaque échantillon dans notre base de données (Nanuq) a un code unique.

  43. Quelles mesures sont incluses dans les tests de CQ?
  44. Tout d'abord, nous mesurons la concentration de chaque échantillon par spectrophotométrie (Nanodrop 1000). En plus de la concentration, nous obtenons aussi des ratios A260/A230 et A260/A280 qui nous permettent d'estimer la présence de contaminants qui pourraient interférer avec les réactions enzymatiques subséquentes.

    Finalement, nous vérifions l'intégrité des ARNs (RIN) en utilisant le Bioanalyseur d'Agilent.

Questions générales sur les services de génotypage
  1. Quelles sont les procédures à suivre pour utiliser les services de génotypage?
  2. Quelles sont la concentration et la quantité d'ADN pour l'échantillon qui doit être envoyé?
  3. Si je n'ai pas suffisamment d'ADN, est-ce que je peux vous envoyer de l'ADN génomique amplifié (whole-genome amplified)?
  4. Comment dois-je envoyer mes échantillons d'ADN et mes amorces?
  5. Avez-vous un format spécifique que je dois utiliser pour créer ma plaque d'ADN?
  6. Dois-je créer un pedigree pour les échantillons qui n'ont pas de pedigree?
  7. Y a-t-il une façon spécifique d'identifier les échantillons?
  8. Comment les génotypes vont-ils nous être livrés?
  9. Quelles sont les étapes de validation et de production?
  10. Quels sont les génotypes de validation et de production?
  11. Combien de temps est nécessaire à la réalisation des projets de génotypage?
Questions sur les services de génotypage microsatellite
  1. Comment les regroupements de marqueurs microsatellite sont-ils faits?
  2. Est-ce que les SNPs sélectionnés doivent être obtenus de la base de données du Centre d'innovation, Nanuq?
  3. Comment dois-je nommer les SNPs sélectionnés?
Réponses
Questions générales sur les services de génotypage
  1. Quelles sont les procédures à suivre pour utiliser les services de génotypage?

    Vous devez contacter Bureau de Gestion des Clients pour demander une soumission. Une fois la soumission acceptée, vous devez remplir le formulaire de réquisition, l'envoyer par courriel (accompagné d'un bon de commande et du certificat d'éthique si l'échantillon est humain) et faxer la première page signée.

  2. Quelles sont la concentration et la quantité d'ADN pour l'échantillon qui doit être envoyé?

    La concentration nécessaire varie selon la technologie que vous souhaitez utiliser.

    Pour le génotypage de microsatellites, TaqMan ou Sequenom® iPLEX, l'ADN doit nous être envoyé à une concentration minimale de 20ng/ul et vous devez en fournir un minimum de 30ul. La quantité exigée peut dépendre de l'ampleur du projet. Idéalement, l'ADN devrait être solubilisé dans l'eau ultrapure.

    Pour le génotypage utilisant la technologie Illumina, l'ADN devrait avoir une concentration minimale de 100ng/ul et la quantité minimale requise est de 25ul. L'ADN doit être dilué dans du tampon TE (10mM Tris-HCl pH 8.0 / 1mM EDTA). Si vous préférez, vous pouvez nous envoyer vos échantillons lyophilisés.

  3. Si je n'ai pas suffisamment d'ADN, est-ce que je peux vous envoyer de l'ADN génomique amplifié (whole-genome amplified)?

    Bien que le taux de génotypage ne soit pas significativement différent de celui de l'ADN non-amplifié, nous avons observé pour ce qui est des technologies d'Illumina, que pour certains SNPs, les agrégats (clusters) se comportent différemment entre l'ADN amplifié et non-amplifié. Donc, il n'est pas recommandé de mélanger des échantillons d'ADN amplifié et non-amplifié dans une même expérience. Notez que s'il s'agit de la seule façon possible de procéder, les SNPs problématiques seront tout simplement enlevés des analyses.

    Dans le cas des technologies de microsatellite, TaqMan ou encore Sequenom® iPLEX, on ne note pas de problèmes particuliers avec l'utilisation d'ADN génomique amplifié.

  4. Comment dois-je envoyer mes échantillons d'ADN et mes amorces?

    Les échantillons doivent être envoyés dans des plaques à 96 puits scellées de façon sécuritaire avec le scellant approprié. Vous devez aussi inclure une représentation schématique de votre plaque avec celle-ci.

  5. Avez-vous un format spécifique que je dois utiliser pour créer ma plaque d'ADN?

    S'il vous plait, veuillez vous référer à la section 'ADN' de chaque technologie pour connaître toutes les informations nécessaires à la création de ce format.

  6. Dois-je créer un pedigree pour les échantillons qui n'ont pas de pedigree?

    Si votre cohorte d'ADN est composée d'individus non-reliés, la création d'un pedigree n'est pas nécessaire. Par contre, si votre cohorte est composée majoritairement d'échantillons ayant un pedigree et seulement quelques individus non-reliés, s'il vous plait insérez les individus non-reliés dans le fichier pedigree. Ces individus non-reliés n'auront aucun lien avec les autres échantillons.

  7. Y a-t-il une façon spécifique d'identifier les échantillons?

    Ce qui est important c'est d'avoir une identification (ID) unique pour chaque échantillon. S'il vous plait, veuillez vous référer à la section 'ADN' de chaque technologie pour connaître toute l'information nécessaire afin d'identifier vos échantillons correctement.

  8. Comment les génotypes vont-ils nous être livrés?

    Les données vous seront transmises dans nos formats standards. La performance de chaque marqueur et le nombre d'erreurs mendéliennes seront résumés. Les résultats seront envoyés comme indiqué dans le Formulaire de demande 1 - Services généraux de génotypage. Aussitôt analysés et vérifiés, les résultats vous seront envoyés soit via courriel ou via FedEx sur un CD-Rom.

  9. Quelles sont les étapes de validation et de production?

    L'étape de validation est la première étape dans les procédures de génotypage. Le but de cette étape est de déterminer les conditions optimales de travail pour vos marqueurs d'intérêt en utilisant un sous-groupe d'échantillons. Ces conditions seront ensuite utilisées dans la deuxième étape des procédures de génotypage : l'étape de production. Si aucune condition ne peut être utilisée pour récupérer les marqueurs échouant au génotypage dans l'étape de validation, le client sera informé et nous lui demanderons de remplacer le marqueur ou de répéter l'étape de validation. Nous procéderons à l'étape de production seulement lorsque des résultats acceptables seront obtenus à l'étape de validation.

  10. Quels sont les génotypes de validation et de production?

    Les génotypes de validation sont les génotypes obtenus lors de l'étape de validation. Les génotypes de production sont les génotypes obtenus lors de l'étape de production.

  11. Combien de temps est nécessaire à la réalisation des projets de génotypage?

    Les projets sont réalisés selon le principe du premier arrivé, premier servi. De plus, le temps nécessaire à l'achèvement d'un projet dépend de la technologie utilisée, du type d'expérience et des détails de cette expérience. S'il vous plait, contactez-nous pour plus d'information sur le temps qui sera nécessaire à la réalisation de votre propre projet.

Questions sur les services de génotypage microsatellite
  1. Comment les regroupements de marqueurs microsatellite sont-ils faits?

    Les marqueurs sont regroupés en groupe de 8 de manière à ce qu'il n'y ait pas de chevauchement entre les grandeurs de fragments pour deux marqueurs ayant le même colorant fluorescent.

  2. Est-ce que les SNPs sélectionnés doivent être obtenus de la base de données du Centre d'innovation, Nanuq?

    Non, néanmoins, il est toujours mieux de choisir des SNPs validés des bases de données publiques. évitez les SNPs localisés dans des régions génomiques répétitives.

  3. Comment dois-je nommer les SNPs sélectionnés?

    La meilleure façon de nommer vos SNPs serait d'inclure le numéro « rs ». S'il n'existe pas, donnez-lui un nom court et informatif. évitez les noms de plus de 15 caractères.

Les questions fréquemment posées pour cette section ainsi que leur réponses ne sont présentement pas disponibles. Vous pouvez cependant adresser vos questions directement au Bureau de gestion clients

Envoi des échantillons
  1. Comment dois-je physiquement organiser mes échantillons et/ou mes amorces lorsque je les envoie au service de séquençage?
  2. Quelle quantité/concentration d'ADN dois-je fournir pour le séquençage?
  3. Quelle quantité/concentration d'amorce dois-je fournir pour le séquençage?
  4. Quelles sont les amorces fournies par le service de séquençage?
  5. Quelles options dois-je choisir lors de la soumission d'échantillons via Nanuq pour obtenir le bon formulaire (étape 1 de la soumission)?
Résultats
  1. Une fois mes échantillons reçus et acceptés par le service de séquençage, quel est le délai pour voir mes séquences sur Nanuq?
  2. Comment voir et analyser mes séquences?
  3. Quelle est la longueur des séquences obtenues?
  4. Que puis-je faire si mes séquences sont de mauvaise qualité?
  5. La séquence texte obtenue dans Nanuq diffère du chromatogramme. Pourquoi?
Facturation
  1. Dois-je fournir un numéro de bon de commande ou de carte de crédit lors de la soumission de mes échantillons?
  2. À qui doit-on envoyer le paiement?
Nanuq
  1. Quels sont les navigateurs Internet compatibles avec Nanuq?
Réponses
Envois des échantillons
  1. Comment dois-je physiquement organiser mes échantillons et/ou mes amorces lorsque je les envoie au service de séquençage?

    Si les échantillons et/ou les amorces sont soumis dans les tubes PCR en "strip" la meilleure façon de les organiser est de regrouper tous les échantillons (plasmides, produits de PCR, phage ou BAC) les uns à la suite des autres en identifiant correctement les tubes par le nom des puits correspondant sur le Formulaire de soumission d'échantillons : A01, A02, A03, etc.

    On procède de la même façon avec les amorces qui doivent être aliquotées dans les tubes PCR en "strip" dans le même ordre que les échantillons auxquels elles correspondent.

    Si les échantillons et/ou les amorces sont soumis dans une plaque de 96 puits, la meilleure façon de les organiser est de regrouper tous les échantillons (plasmides, produits de PCR, phage ou BAC) les uns à la suite des autres en commençant par le puits A01 et en suivant l'ordre de la plaque, c'est-à-dire de A01 à A12, B01 à B12 et ainsi de suite.

    Les amorces peuvent être aliquotées dans la même plaque dans les rangées inférieures si l'espace le permet ou dans une autre plaque clairement identifiée.

    Les échantillons et les amorces doivent être organisés exactement comme sur votre Formulaire de soumission d'échantillons.

    De plus, il est important de noter que :

    • Si un échantillon doit être séquencé avec deux amorces ou plus, l'échantillon doit être aliquoté dans autant de tubes (ou puits) qu'il y a d'amorces.
    • Si une amorce doit être utilisé pour deux échantillons ou plus, l'amorce doit être aliquotée dans autant de tubes (ou puits) qu'il y a d'échantillons à séquencer.
    • Si les échantillons soumis sont de différents types (plasmides, PCR purifies, PCR non purifies, phage ou BAC), veuillez regrouper les échantillons par type d'ADN soumis.
    • Si une partie des amorces requises sont des amorces fournies par le service de séquençage, veuillez regrouper les échantillons correspondants.

    Télécharger les fichiers d'exemple

    Vous devez remplir la plaque 1 du Formulaire de soumission d'échantillons avant de placer des échantillons dans la plaque 2.

  2. Quelle quantité/concentration d'ADN dois-je fournir pour le séquençage?

    Les volumes et quantités requis par échantillon à séquencer sont:


    Volume Concentration
    Produits de PCR non purifiés 20 µl minimum Les amplifications PCR doivent ?tre v?rifi?es par migration sur gel d'agarose et une copie de la photo du gel doit ?tre envoy?e au Service de s?quen?age avec les ?chantillons.

    Les produits de PCR de moins de 250 pb donnent des s?quences de moindre qualit? en raison d'un ph?nom?ne de saturation (plus les fragments sont petits plus ils sont, en g?n?ral, concentr?s et plus le signal de la s?quence obtenue est intense) et de compression des bases qui se produit au d?but et ? la fin de toutes les s?quences (ph?nom?ne reli? ? l'?lectrophor?se en capillaires des s?quenceurs 3730xl d'ABI).

    Des produits de PCR de plus de 2000 pb pourraient ?tre difficiles ? s?quencer, la concentration d'ADN devenant un facteur limitant. En effet plus un produit de PCR est long plus sa concentration doit ?tre ?lev?e pour obtenir un r?sultat de s?quen?age satisfaisant.
    Produits de PCR purifiés 7,5 µl minimum
    ADN plasmidique ou phage 7,5 µl minimum 100-500 ng/µl
    Extrémités de BAC/PAC 20 µl minimum 500 ng/µl minimum
  3. Quelle quantité/concentration d'amorce dois-je fournir pour le séquençage?

    Les volume et quantité requis par échantillon à séquencer sont:

    Volume Concentration
    Amorce 10 µl 5 µM
  4. Quelles sont les amorces fournies par le service de séquençage?

    Le service de séquençage offre gratuitement les amorces universelles suivantes:

    T7 5' - TAATACGACTCACTATAGGG - 3'
    T3 5' - AATTAACCCTCACTAAAGGG - 3'
    SP6 5' - TATTTAGGTGACACTATAG - 3'
    M13 forward 5' - GTAAAACGACGGCCAGT - 3'
    M13 reverse 5' - GGAAACAGCTATGACCATG - 3'
    BGH reverse 5' - TAGAAGGCACAGTCGAGG - 3'
    T7 terminateur 5' - GCTAGTTATTGCTCAGCGG - 3'
    pGEXF 5' - GGGCTGGCAAGCCACGTTTGGTG - 3'
    pGEXR 5' - CCGGGAGCTGCATGTGTCAGAGG - 3'
  5. Quelles options dois-je choisir lors de la soumission d'échantillons via Nanuq pour obtenir le bon formulaire (étape 1 de la soumission)?

    à la question « Quel type de service est requis? » répondez « Préparation d'ADN » uniquement si vous soumettez des colonies bactériennes fraîches ou des stocks de glycérol. Répondez « Séquençage » si vous soumettez des plasmides déjà extraits, des produits de PCR (purifiés ou non), des phages ou des BAC.

    Répondez NON à la question « Comptez-vous utiliser notre service de découverte de SNP post séquençage? ». Si toutefois vous désirez avoir de l'information sur ce service, veuillez communiquer avec le directeur du service de séquençage Pierre Lepage au 514-398-3311 poste 00346 ou par courriel.

    Finalement répondez à la question « Quel type de contenant utilisez-vous? » et téléchargez le formulaire.

Résultats
  1. Une fois mes échantillons reçus et acceptés par le service de séquençage, quel est le délai pour voir mes séquences sur Nanuq?

    Une fois les échantillons acceptés, le délai normal de séquençage est de 2 à 4 jours.

  2. Comment puis-je voir et analyser mes séquences?

    Dans la page d'accueil de Nanuq, cliquez sur votre nom de projet sous « Résultats/données du projet ». Choisissez le numéro de lot de soumission correspondant aux séquences que vous voulez voir et cliquez sur la date de séquençage correspondante.

    Vous pouvez alors regarder le chromatogramme en cliquant sur T (sous trace) ou regarder la séquence texte en cliquant sur la longueur de la séquence.

    Il est possible de télécharger le(s) chromatogramme(s) (format AB1 ou SCF) ou la séquence texte en choisissant « Recherche/Téléchargement données » sous l'onglet outils du menu du haut.

  3. Quelle est la longueur des séquences obtenues?

    A partir d'échantillons de bonne qualité et en quantité suffisante, les séquences obtenues devraient être de bonne qualité jusqu'à 800 pb.

  4. Que puis-je faire si mes séquences sont de mauvaise qualité?

    Une fois que vous avez vérifié la quantité et la qualité de vos échantillons, n'hésitez pas à communiquer avec le service de séquençage afin d'obtenir de l'aide pour tenter d'améliorer vos résultats.

    Service de Séquençage
    514-398-3311 Poste 00522
    courriel

  5. La séquence texte obtenue dans Nanuq diffère du chromatogramme. Pourquoi?

    Il est essentiel de toujours regarder le chromatogramme afin de vérifier la qualité de votre séquence. Le programme qui effectue l'attribution des bases peut, lorsque la séquence est de mauvaise qualité, mal identifier certaines bases (par exemple de début et fin des séquences).

    Il est donc fortement recommandé d'utiliser la fonction « Masquer la séquence » lorsque vous regardez la séquence en version texte dans Nanuq (dans le menu de gauche, sous l'onglet « Manipulation »). Cette fonction permet de masquer les bases de qualité inférieure au seuil de qualité choisi (15 par défaut). Ces bases seront remplacées par un « N ».

Facturation
  1. Dois-je fournir un numéro de bon de commande ou de carte crédit lors de la soumission de mes échantillons?

    Avant tout, il est important d'indiquer le mode de paiement que vous souhaitez utiliser dans la section « Mode de Paiement » du formulaire de demande de séquençage (lors de l'ouverture de compte).

    Si vous vous désirez payer par chèque, le numéro de bon de commande est requis pour chaque soumission d'échantillons. Un espace est prévu à cette fin à la ligne 15 du fichier Excel de soumission d'échantillons (Numéro de bon de commande).

    Si vous désirez payer par carte de crédit, il n'est pas nécessaire de fournir le numéro de carte de crédit au moment de la soumission des échantillons. Il vous sera demandé ultérieurement lors de la facturation.

  2. À qui doit-on envoyer le paiement?

    Suivez le lien pour en connaître d'avantage sur les paiements.

Nanuq
  1. Quels sont les navigateurs Internet compatibles avec Nanuq?

    Les principaux navigateurs Internet compatibles avec Nanuq (pour MAC et PC) sont :

    • Firefox version 1.0.7 et plus
    • Explorer version 6.0 et plus